| Accession | MI0000436 |
| Name | hsa-mir-1b-2 |
|
entry is obsolete
|
MI0000436 -> MI0000651 The 3' end of miR-1b conflicts with the precursor sequences and genome assemblies. miR-1b, 1c and 1d are merged into mir-1-1 and mir-1-2. |
| Organism | Homo sapiens |
| Sequence (5' -> 3') (85 nts) |
GCCUGCUUGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAGUAUGUAUCUCAGGCCGGG |
| MFE | -39.90 kcal/mol |
| first miRBase version | 2.0 |
| last miRBase version | 2.0 |
| Links | HMDD |