Accession | MI0000435 |
Name | hsa-mir-1b-1 |
entry is obsolete
|
MI0000435 -> MI0000651 The 3' end of miR-1b conflicts with the precursor sequences and genome assemblies. miR-1b, 1c and 1d are merged into mir-1-1 and mir-1-2. |
Organism | Homo sapiens |
Sequence (5' -> 3') (85 nts) |
ACCUACUCAGAGUACAUACUUCUUUAUGUACCCAUAUGAACAUACAAUGCUAUGGAAUGUAAAGAAGUAUGUAUUUUUGGUAGGC |
MFE | -35.60 kcal/mol |
first miRBase version | 2.0 |
last miRBase version | 2.0 |
Links | HMDD |