Accession | MI0000405 | ||||||
Name | mmu-let-7d | ||||||
similar to following miRCarta precursors | mmu-90-98.1 | ||||||
potential naming conflicts with | mmu-let-7d-5p (MIMAT0000383) | ||||||
Organism | Mus musculus | ||||||
Genome | GRCm38.p5 | ||||||
Location |
chr13:48,536,012-48,536,114 (-) |
||||||
miRNA | mmu-let-7d-5p | ||||||
miRNA | mmu-let-7d-3p | ||||||
Sequence (5' -> 3') (103 nts) |
AAUGGGUUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGAGAUUUUGCCCACAAGGAGUUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUUAUU | ||||||
MFE | -48.90 kcal/mol | ||||||
first miRBase version | 2.1 | ||||||
last miRBase version | 21.0 | ||||||
Clusters (10 kb) (3 precursors) |
mmu-let-7d mmu-let-7f-1 mmu-let-7a-1 |
||||||
Family | let-7 (MIPF0000002) | ||||||
Experiments |
|
||||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
2 | Houbaviy et al. | Dev. Cell | 2003 | 12919684 | Embryonic stem cell-specific MicroRNAs. |
3 | Poy et al. | Nature | 2004 | 15538371 | A pancreatic islet-specific microRNA regulates insulin secretion. |
4 | Watanabe et al. | Genes Dev. | 2006 | 16766679 | Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes. |
5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
6 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
7 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |