Precursor miRBase

mmu-let-7d (MI0000405)

Accession MI0000405
Name mmu-let-7d
similar to following miRCarta precursors mmu-90-98.1
potential naming conflicts with mmu-let-7d-5p (MIMAT0000383)
Organism Mus musculus
Genome GRCm38.p5
Location chr13:48,536,012-48,536,114 (-)
miRNA mmu-let-7d-5p
miRNA mmu-let-7d-3p
Sequence (5' -> 3')
(103 nts)
AAUGGGUUCCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGAGAUUUUGCCCACAAGGAGUUAACUAUACGACCUGCUGCCUUUCUUAGGGCCUUAUU
MFE -48.90 kcal/mol
first miRBase version 2.1
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
mmu-let-7d
mmu-let-7f-1
mmu-let-7a-1
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 12919684 17604727
External DBs
Gene symbol Mirlet7d
NCBI Gene 387247

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
3 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
4 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
5 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
6 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.
7 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.