Precursor miRBase

hsa-mir-221 (MI0000298)

Accession MI0000298
Name hsa-mir-221
similar to following miRCarta precursors hsa-405-91.1
Organism Homo sapiens
Genome GRCh38.p10
Location chrX:45,746,157-45,746,266 (-)
miRNA hsa-miR-221-5p
miRNA hsa-miR-221-3p
Sequence (5' -> 3')
(110 nts)
UGAACAUCCAGGUCUGGGGCAUGAACCUGGCAUACAAUGUAGAUUUCUGUGUUCGUUAGGCAACAGCUACAUUGUCUGCUGGGUUUCAGGCUACCUGGAAACAUGUUCUC
MFE -46.50 kcal/mol
first miRBase version 1.2
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-221
hsa-mir-222
Family mir-221 (MIPF0000051)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR221
NCBI Gene 407006

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
2 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
3 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.