| Accession | MI0000289 | ||||
| Name | hsa-mir-181a-1 | ||||
| similar to following miRCarta precursors | hsa-32-125.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr1:198,859,044-198,859,153 (-) |
||||
| miRNA | hsa-miR-181a-5p | ||||
| miRNA | hsa-miR-181a-3p | ||||
| Sequence (5' -> 3') (110 nts) |
UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUCAAAACCAUCGACCGUUGAUUGUACCCUAUGGCUAACCAUCAUCUACUCCA | ||||
| MFE | -35.00 kcal/mol | ||||
| first miRBase version | 1.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (2 precursors) |
hsa-mir-181b-1
hsa-mir-181a-1 |
||||
| Family | mir-181 (MIPF0000007) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 2 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 3 | Weber et al. | FEBS J. | 2005 | 15634332 | New human and mouse microRNA genes found by homology search. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 6 | Marton et al. | Leukemia | 2008 | 17989717 | Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis. |