| Accession | MI0000285 | ||||
| Name | hsa-mir-205 | ||||
| similar to following miRCarta precursors | hsa-351-932.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr1:209,432,133-209,432,242 (+) |
||||
| miRNA | hsa-miR-205-5p | ||||
| miRNA | hsa-miR-205-3p | ||||
| Sequence (5' -> 3') (110 nts) |
AAAGAUCCUCAGACAAUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCAUGGAGCUGACA | ||||
| MFE | -45.40 kcal/mol | ||||
| first miRBase version | 1.2 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (1 precursors) |
hsa-mir-205 |
||||
| Family | mir-205 (MIPF0000058) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 4 | Zhu et al. | J. Virol. | 2009 | 19144710 | Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas. |