| Accession | MI0000281 | ||||||
| Name | hsa-mir-199a-2 | ||||||
| similar to following miRCarta precursors | hsa-86-46.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr1:172,144,535-172,144,644 (-) |
||||||
| miRNA | hsa-miR-199a-5p | ||||||
| miRNA | hsa-miR-199a-3p | ||||||
| Sequence (5' -> 3') (110 nts) |
AGGAAGCUUCUGGAGAUCCUGCUCCGUCGCCCCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUUAGACUGGGCAAGGGAGAGCA | ||||||
| MFE | -42.30 kcal/mol | ||||||
| first miRBase version | 1.2 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-214
hsa-mir-3120 hsa-mir-199a-2 |
||||||
| Family | mir-199 (MIPF0000040) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
| 2 | Lim et al. | Science | 2003 | 12624257 | Vertebrate microRNA genes. |
| 3 | Fu et al. | FEBS Lett. | 2005 | 15978578 | Identification of human fetal liver miRNAs by a novel method. |
| 4 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
| 5 | Koh et al. | BMC Genomics | 2010 | 20158877 | Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha. |