| Accession | MI0000258 |
| Name | mmu-mir-1b |
| potential naming conflicts with | mmu-mir-1a-2 (MI0000652) mmu-mir-1b (MI0006283) |
|
entry is obsolete
|
MI0000258 -> MI0000139 The 3' end of miR-1b conflicts with the precursor sequences and genome assemblies. miR-1b, 1c and 1d are merged into mir-1-1 and mir-1-2. |
| Organism | Mus musculus |
| Sequence (5' -> 3') (79 nts) |
UACUCAGAGCACAUACUUCUUUAUGUACCCAUAUGAACAUUCAGUGCUAUGGAAUGUAAAGAAGUAUGUAUUUUGGGUA |
| MFE | -31.20 kcal/mol |
| first miRBase version | 1.1 |
| last miRBase version | 2.0 |