Precursor miRBase

hsa-mir-199a-1 (MI0000242)

Accession MI0000242
Name hsa-mir-199a-1
similar to following miRCarta precursors hsa-85-47.1
potential naming conflicts with hsa-mir-199a-1 (MI0000280)
Organism Homo sapiens
Genome GRCh38.p10
Location chr19:10,817,426-10,817,496 (-)
miRNA hsa-miR-199a-5p
miRNA hsa-miR-199a-3p
Sequence (5' -> 3')
(71 nts)
GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCUGCACAUUGGUUAGGC
MFE -28.50 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
hsa-mir-199a-1
Family mir-199 (MIPF0000040)
Experiments
experiment Pubmed link
Illumina 20158877
cloned 17604727
External DBs
Gene symbol MIR199A1
NCBI Gene 406976

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. RNA 2003 12554859 New microRNAs from mouse and human.
2 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
3 Fu et al. FEBS Lett. 2005 15978578 Identification of human fetal liver miRNAs by a novel method.
4 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
5 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.