Accession | MI0000236 | ||||
Name | mmu-mir-194-1 | ||||
similar to following miRCarta precursors | mmu-131-24214.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr1:185,313,319-185,313,385 (+) |
||||
miRNA | mmu-miR-194-5p | ||||
miRNA | mmu-miR-194-1-3p | ||||
Sequence (5' -> 3') (67 nts) |
AUCGGGUGUAACAGCAACUCCAUGUGGACUGUGCUCGGAUUCCAGUGGAGCUGCUGUUACUUCUGAU | ||||
MFE | -34.10 kcal/mol | ||||
first miRBase version | 1.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (2 precursors) |
mmu-mir-194-1 mmu-mir-215 |
||||
Family | mir-194 (MIPF0000055) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Michael et al. | Mol. Cancer Res. | 2003 | 14573789 | Reduced accumulation of specific microRNAs in colorectal neoplasia. |
2 | Lagos-Quintana et al. | RNA | 2003 | 12554859 | New microRNAs from mouse and human. |
3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
4 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
5 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |