Accession | MI0000168 | ||||
Name | mmu-mir-144 | ||||
similar to following miRCarta precursors | mmu-170-318.1 | ||||
Organism | Mus musculus | ||||
Genome | GRCm38.p5 | ||||
Location |
chr11:78,073,005-78,073,070 (+) |
||||
miRNA | mmu-miR-144-5p | ||||
miRNA | mmu-miR-144-3p | ||||
Sequence (5' -> 3') (66 nts) |
GGCUGGGAUAUCAUCAUAUACUGUAAGUUUGUGAUGAGACACUACAGUAUAGAUGAUGUACUAGUC | ||||
MFE | -28.60 kcal/mol | ||||
first miRBase version | 1.1 | ||||
last miRBase version | 21.0 | ||||
Clusters (10 kb) (3 precursors) |
mmu-mir-144 mmu-mir-451a mmu-mir-451b |
||||
Family | mir-144 (MIPF0000093) | ||||
Experiments |
|
||||
External DBs |
|
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Lagos-Quintana et al. | Curr. Biol. | 2002 | 12007417 | Identification of tissue-specific microRNAs from mouse. |
2 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |
3 | Chiang et al. | Genes Dev. | 2010 | 20413612 | Mammalian microRNAs: experimental evaluation of novel and previously annotated genes. |
4 | Ahn et al. | Mol. Hum. Reprod. | 2010 | 20215419 | MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing. |