Precursor miRBase

mmu-mir-144 (MI0000168)

Accession MI0000168
Name mmu-mir-144
similar to following miRCarta precursors mmu-170-318.1
Organism Mus musculus
Genome GRCm38.p5
Location chr11:78,073,005-78,073,070 (+)
miRNA mmu-miR-144-5p
miRNA mmu-miR-144-3p
Sequence (5' -> 3')
(66 nts)
GGCUGGGAUAUCAUCAUAUACUGUAAGUUUGUGAUGAGACACUACAGUAUAGAUGAUGUACUAGUC
MFE -28.60 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(3 precursors)
mmu-mir-144
mmu-mir-451a
mmu-mir-451b
Family mir-144 (MIPF0000093)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir144
NCBI Gene 387162

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
3 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.