Precursor miRBase

mmu-mir-135a-1 (MI0000161)

Accession MI0000161
Name mmu-mir-135a-1
similar to following miRCarta precursors mmu-520-24942.1
Organism Mus musculus
Genome GRCm38.p5
Location chr9:106,154,124-106,154,213 (+)
miRNA mmu-miR-135a-5p
miRNA mmu-miR-135a-1-3p
Sequence (5' -> 3')
(90 nts)
AGGCCUCACUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUAUUGCUCGCUCAUAUAGGGAUUGGAGCCGUGGCGUACGGUGAGGAUA
MFE -42.60 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-135a-1
Family mir-135 (MIPF0000028)
Experiments
experiment Pubmed link
Illumina 20215419 20413612
cloned 17604727
External DBs
Gene symbol Mir135a-1
NCBI Gene 387153

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Weber et al. FEBS J. 2005 15634332 New human and mouse microRNA genes found by homology search.
3 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
4 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.
5 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.