Precursor miRBase

mmu-mir-130a (MI0000156)

Accession MI0000156
Name mmu-mir-130a
similar to following miRCarta precursors mmu-622-24334.1
Organism Mus musculus
Genome GRCm38.p5
Location chr2:84,741,115-84,741,178 (-)
miRNA mmu-miR-130a-5p
miRNA mmu-miR-130a-3p
Sequence (5' -> 3')
(64 nts)
GAGCUCUUUUCACAUUGUGCUACUGUCUAACGUGUACCGAGCAGUGCAAUGUUAAAAGGGCAUC
MFE -22.10 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
mmu-mir-130a
Family mir-130 (MIPF0000034)
Experiments
experiment Pubmed link
Illumina 20413612
External DBs
Gene symbol Mir130a
NCBI Gene 387149

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Curr. Biol. 2002 12007417 Identification of tissue-specific microRNAs from mouse.
2 Houbaviy et al. Dev. Cell 2003 12919684 Embryonic stem cell-specific MicroRNAs.
3 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
4 Poy et al. Nature 2004 15538371 A pancreatic islet-specific microRNA regulates insulin secretion.
5 Watanabe et al. Genes Dev. 2006 16766679 Identification and characterization of two novel classes of small RNAs in the mouse germline: retrotransposon-derived siRNAs in oocytes and germline small RNAs in testes.
6 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
7 Chiang et al. Genes Dev. 2010 20413612 Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
8 Ahn et al. Mol. Hum. Reprod. 2010 20215419 MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing.