Precursor miRBase

dme-mir-9a (MI0000129)

Accession MI0000129
Name dme-mir-9a
similar to following miRCarta precursors dme-31804-34743.1
Organism Drosophila melanogaster
Genome BDGP5.0
Location 3L:19,558,231-19,558,308 (+)
miRNA dme-miR-9a-5p
miRNA dme-miR-9a-3p
Sequence (5' -> 3')
(78 nts)
GCUAUGUUGUCUUUGGUUAUCUAGCUGUAUGAGUGAUAAAUAACGUCAUAAAGCUAGCUUACCGAAGUUAAUAUUAGC
MFE -28.50 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
dme-mir-9a
Family mir-9 (MIPF0000014)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Aravin et al. Dev. Cell 2003 12919683 The small RNA profile during Drosophila melanogaster development.
3 Sempere et al. Dev. Biol. 2003 12812784 Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity.
4 Stark et al. Genome Res. 2007 17989255 Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes.
5 Ruby et al. Genome Res. 2007 17989254 Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs.