| Accession | MI0000129 |
| Name | dme-mir-9a |
| similar to following miRCarta precursors | dme-31804-34743.1 |
| Organism | Drosophila melanogaster |
| Genome | BDGP5.0 |
| Location |
3L:19,558,231-19,558,308 (+) |
| miRNA | dme-miR-9a-5p |
| miRNA | dme-miR-9a-3p |
| Sequence (5' -> 3') (78 nts) |
GCUAUGUUGUCUUUGGUUAUCUAGCUGUAUGAGUGAUAAAUAACGUCAUAAAGCUAGCUUACCGAAGUUAAUAUUAGC |
| MFE | -28.50 kcal/mol |
| first miRBase version | 1.1 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
dme-mir-9a |
| Family | mir-9 (MIPF0000014) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Science | 2001 | 11679670 | Identification of novel genes coding for small expressed RNAs. |
| 2 | Aravin et al. | Dev. Cell | 2003 | 12919683 | The small RNA profile during Drosophila melanogaster development. |
| 3 | Sempere et al. | Dev. Biol. | 2003 | 12812784 | Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-Complex gene activity. |
| 4 | Stark et al. | Genome Res. | 2007 | 17989255 | Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes. |
| 5 | Ruby et al. | Genome Res. | 2007 | 17989254 | Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs. |