| Accession | MI0000098 | ||||
| Name | hsa-mir-96 | ||||
| similar to following miRCarta precursors | hsa-248-1380.1 | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr7:129,774,692-129,774,769 (-) |
||||
| miRNA | hsa-miR-96-5p | ||||
| miRNA | hsa-miR-96-3p | ||||
| Sequence (5' -> 3') (78 nts) |
UGGCCGAUUUUGGCACUAGCACAUUUUUGCUUGUGUCUCUCCGCUCUGAGCAAUCAUGUGCAGUGCCAAUAUGGGAAA | ||||
| MFE | -34.80 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-mir-182
hsa-mir-96 hsa-mir-183 |
||||
| Family | mir-96 (MIPF0000072) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
| 2 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 3 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |