| Accession | MI0000071 | ||||||
| Name | hsa-mir-17 | ||||||
| similar to following miRCarta precursors | hsa-88-113.1 | ||||||
| Organism | Homo sapiens | ||||||
| Genome | GRCh38.p10 | ||||||
| Location |
chr13:91,350,605-91,350,688 (+) |
||||||
| miRNA | hsa-miR-17-5p | ||||||
| miRNA | hsa-miR-17-3p | ||||||
| Sequence (5' -> 3') (84 nts) |
GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC | ||||||
| MFE | -33.80 kcal/mol | ||||||
| first miRBase version | 1.1 | ||||||
| last miRBase version | 21.0 | ||||||
| Clusters (10 kb) (6 precursors) |
hsa-mir-17 hsa-mir-18a hsa-mir-19a hsa-mir-20a hsa-mir-19b-1 hsa-mir-92a-1 |
||||||
| Family | mir-17 (MIPF0000001) | ||||||
| Experiments |
|
||||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Science | 2001 | 11679670 | Identification of novel genes coding for small expressed RNAs. |
| 2 | Mourelatos et al. | Genes Dev. | 2002 | 11914277 | miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. |
| 3 | Dostie et al. | RNA | 2003 | 12554860 | Numerous microRNPs in neuronal cells containing novel microRNAs. |
| 4 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 5 | Suh et al. | Dev. Biol. | 2004 | 15183728 | Human embryonic stem cells express a unique set of microRNAs. |
| 6 | Fu et al. | FEBS Lett. | 2005 | 15978578 | Identification of human fetal liver miRNAs by a novel method. |
| 7 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 8 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |