Precursor miRBase

hsa-mir-16-1 (MI0000070)

Accession MI0000070
Name hsa-mir-16-1
similar to following miRCarta precursors hsa-62-415.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr13:50,048,973-50,049,061 (-)
miRNA hsa-miR-16-5p
miRNA hsa-miR-16-1-3p
Sequence (5' -> 3')
(89 nts)
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC
MFE -36.50 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-mir-16-1
hsa-mir-15a
Family mir-15 (MIPF0000006)
Experiments
experiment Pubmed link
cloned 17604727
External DBs
Gene symbol MIR16-1
NCBI Gene 406950

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Mourelatos et al. Genes Dev. 2002 11914277 miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs.
3 Calin et al. Proc. Natl. Acad. Sci. U.S.A. 2002 12434020 Frequent deletions and down-regulation of micro- RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia.
4 Lim et al. Science 2003 12624257 Vertebrate microRNA genes.
5 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
6 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
7 Suh et al. Dev. Biol. 2004 15183728 Human embryonic stem cells express a unique set of microRNAs.
8 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
9 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.