| Accession | MI0000063 | ||||
| Name | hsa-let-7b | ||||
| similar to following miRCarta precursors | hsa-14-171.1 | ||||
| potential naming conflicts with | hsa-let-7b-5p (MIMAT0000063) | ||||
| Organism | Homo sapiens | ||||
| Genome | GRCh38.p10 | ||||
| Location |
chr22:46,113,686-46,113,768 (+) |
||||
| miRNA | hsa-let-7b-5p | ||||
| miRNA | hsa-let-7b-3p | ||||
| Sequence (5' -> 3') (83 nts) |
CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAACUAUACAACCUACUGCCUUCCCUG | ||||
| MFE | -46.70 kcal/mol | ||||
| first miRBase version | 1.1 | ||||
| last miRBase version | 21.0 | ||||
| Clusters (10 kb) (3 precursors) |
hsa-let-7a-3
hsa-mir-4763 hsa-let-7b |
||||
| Family | let-7 (MIPF0000002) | ||||
| Experiments |
|
||||
| External DBs |
|
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Lagos-Quintana et al. | Science | 2001 | 11679670 | Identification of novel genes coding for small expressed RNAs. |
| 2 | Michael et al. | Mol. Cancer Res. | 2003 | 14573789 | Reduced accumulation of specific microRNAs in colorectal neoplasia. |
| 3 | Kasashima et al. | Biochem. Biophys. Res. Commun. | 2004 | 15325244 | Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells. |
| 4 | Lui et al. | Cancer Res. | 2007 | 17616659 | Patterns of known and novel small RNAs in human cervical cancer. |
| 5 | Landgraf et al. | Cell | 2007 | 17604727 | A mammalian microRNA expression atlas based on small RNA library sequencing. |