Precursor miRBase

hsa-let-7a-2 (MI0000061)

Accession MI0000061
Name hsa-let-7a-2
similar to following miRCarta precursors hsa-6-426.1
Organism Homo sapiens
Genome GRCh38.p10
Location chr11:122,146,522-122,146,593 (-)
miRNA hsa-let-7a-5p
miRNA hsa-let-7a-2-3p
Sequence (5' -> 3')
(72 nts)
AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU
MFE -25.20 kcal/mol
first miRBase version 1.1
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
hsa-let-7a-2
hsa-mir-100
Family let-7 (MIPF0000002)
Experiments
experiment Pubmed link
qRT-PCR 19015728
External DBs
Gene symbol MIRLET7A2
NCBI Gene 406882

External tools

Links
HMDD

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Lagos-Quintana et al. Science 2001 11679670 Identification of novel genes coding for small expressed RNAs.
2 Dostie et al. RNA 2003 12554860 Numerous microRNPs in neuronal cells containing novel microRNAs.
3 Michael et al. Mol. Cancer Res. 2003 14573789 Reduced accumulation of specific microRNAs in colorectal neoplasia.
4 Suh et al. Dev. Biol. 2004 15183728 Human embryonic stem cells express a unique set of microRNAs.
5 Kasashima et al. Biochem. Biophys. Res. Commun. 2004 15325244 Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells.
6 Lui et al. Cancer Res. 2007 17616659 Patterns of known and novel small RNAs in human cervical cancer.
7 Landgraf et al. Cell 2007 17604727 A mammalian microRNA expression atlas based on small RNA library sequencing.
8 Tzur et al. PLoS ONE 2008 19015728 MicroRNA expression patterns and function in endodermal differentiation of human embryonic stem cells.
9 Marton et al. Leukemia 2008 17989717 Small RNAs analysis in CLL reveals a deregulation of miRNA expression and novel miRNA candidates of putative relevance in CLL pathogenesis.
10 Koh et al. BMC Genomics 2010 20158877 Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha.