Precursor miRBase

oha-mir-99b (MI0031496)

Accession MI0031496
Name oha-mir-99b
similar to following miRCarta precursors oha-37059-37058.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01003436.1:63,475-63,553 (-)
miRNA oha-miR-99b-5p
miRNA oha-miR-99b-3p
Sequence (5' -> 3')
(79 nts)
GGUUGCCAUAAACCCGUAGAUCCGAACUUGCGGUACCACUGCUUCACACAAGCUCGAGUCUGUGGGUAUGUGUCGACCU
MFE -30.80 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-let-7c-2
oha-mir-99b
Family mir-10 (MIPF0000033)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.