Precursor miRBase

oha-mir-99a (MI0031495)

Accession MI0031495
Name oha-mir-99a
similar to following miRCarta precursors oha-64-36927.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000064.1:967,763-967,852 (+)
miRNA oha-miR-99a-5p
miRNA oha-miR-99a-3p
Sequence (5' -> 3')
(90 nts)
GAGUGCCAAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAAUACUGUGCACAAGCUCGUUUCUAUGGGUCAGUGUCAGUCUGGUGA
MFE -39.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-99a
oha-let-7c-3
Family mir-10 (MIPF0000033)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.