Accession | MI0031495 |
Name | oha-mir-99a |
similar to following miRCarta precursors | oha-64-36927.1 |
Organism | Ophiophagus hannah |
Genome | OphHan1.0 |
Location |
AZIM01000064.1:967,763-967,852 (+) |
miRNA | oha-miR-99a-5p |
miRNA | oha-miR-99a-3p |
Sequence (5' -> 3') (90 nts) |
GAGUGCCAAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAAUACUGUGCACAAGCUCGUUUCUAUGGGUCAGUGUCAGUCUGGUGA |
MFE | -39.90 kcal/mol |
first miRBase version | 21.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (2 precursors) |
oha-mir-99a oha-let-7c-3 |
Family | mir-10 (MIPF0000033) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |