Precursor miRBase

oha-mir-9-2 (MI0031488)

Accession MI0031488
Name oha-mir-9-2
similar to following miRCarta precursors oha-29475-36959.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000360.1:98,944-99,023 (-)
miRNA oha-miR-9-2-5p
miRNA oha-miR-9-3p
Sequence (5' -> 3')
(80 nts)
GGAGUUUUUACUUUCGGUUAUCUAGCUUUAUGAAGACCAACACACUCAUACAGCUAGAUAACCAAAGAUAACAACUCACU
MFE -30.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-9-2
Family mir-9 (MIPF0000014)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.