Precursor miRBase

oha-mir-429 (MI0031469)

Accession MI0031469
Name oha-mir-429
similar to following miRCarta precursors oha-36950-36949.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000256.1:137,861-137,949 (+)
miRNA oha-miR-429-5p
miRNA oha-miR-429-3p
Sequence (5' -> 3')
(89 nts)
CUGCUUGCCGGCCGAUCGCUGUCUUACCAGACAAAUUUAGAUCUUAAUCUAUCGCUGUCUAAUACUGUCUGGUAAUGCCGUCGAUUUGC
MFE -24.40 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-200a
oha-mir-429
Family mir-8 (MIPF0000019)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.