Precursor miRBase

oha-mir-383 (MI0031467)

Accession MI0031467
Name oha-mir-383
similar to following miRCarta precursors oha-862-1756.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001937.1:343,504-343,585 (+)
miRNA oha-miR-383-5p
miRNA oha-miR-383-3p
Sequence (5' -> 3')
(82 nts)
ACCUGCUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGUUUGAUAUGAAACAGCCACAGCACUGCCUGGUCAGAAAGAGCAAG
MFE -35.30 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-383
Family mir-383 (MIPF0000137)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.