Precursor miRBase

oha-mir-365a-1 (MI0031464)

Accession MI0031464
Name oha-mir-365a-1
similar to following miRCarta precursors oha-36954-176.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000267.1:83,635-83,726 (-)
miRNA oha-miR-365a-1-5p
miRNA oha-miR-365a-3p
Sequence (5' -> 3')
(92 nts)
UUUGCGCAGGGAAAAUGAGGGACUUUUGGGGGCAGCUGUGUUUUUCCAUGCUACCAUAAUGCCCCUAAAAAUCCUUAUUGCUCUUGCCGUAU
MFE -34.80 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-365a-1
Family mir-365 (MIPF0000061)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.