Precursor miRBase

oha-mir-33-2 (MI0031457)

Accession MI0031457
Name oha-mir-33-2
similar to following miRCarta precursors oha-257-36951.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000256.1:222,162-222,251 (-)
miRNA oha-miR-33-5p
miRNA oha-miR-33-3p
Sequence (5' -> 3')
(90 nts)
ACUAUGGCUGUGUCGGUGGUGCAUUGUAGUUGCAUUGCAUGUGCAAGUGAAGAUGUGCAAUGCCCCUUCAGUGCAGCCCUGGGGCAGCAC
MFE -41.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-33-2
Family mir-33 (MIPF0000070)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.