Precursor miRBase

oha-mir-30d (MI0031454)

Accession MI0031454
Name oha-mir-30d
similar to following miRCarta precursors oha-21-37079.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01004649.1:79,018-79,101 (-)
miRNA oha-miR-30d-5p
miRNA oha-miR-30d-3p
Sequence (5' -> 3')
(84 nts)
UUGUAGUCUGUUGUUGUAAACAUCCCCGACUGGAAGCUGGAAAACGUAGCUUUCAGUCCGAUGUUUGCUGCUGCUGGCUACUCA
MFE -40.20 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-30b
oha-mir-30d
Family mir-30 (MIPF0000005)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.