Precursor miRBase

oha-mir-301b (MI0031447)

Accession MI0031447
Name oha-mir-301b
similar to following miRCarta precursors oha-37084-26706.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01005047.1:53,445-53,543 (-)
miRNA oha-miR-301b-5p
miRNA oha-miR-301b-3p
Sequence (5' -> 3')
(99 nts)
GCCACUGCUGGAACCGCCGGCUCUGACAAUAUUGCACUACUGUUUAUCUCAAAUUUAGCAGUGCAAUAAUAUUGUCAAAGCAUUUGGUUCCAGUUCUGA
MFE -39.90 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-301b
oha-mir-130a
Family mir-130 (MIPF0000034)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.