Precursor miRBase

oha-mir-26-2 (MI0031435)

Accession MI0031435
Name oha-mir-26-2
similar to following miRCarta precursors oha-34-37037.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01002704.1:89,219-89,298 (+)
miRNA oha-miR-26-5p
miRNA oha-miR-26-2-3p
Sequence (5' -> 3')
(80 nts)
CUGCGACCGGGUUCAAGUAAUCCAGGAUAGGCUGUGUGCAAUCUUAAUGGCCUAUCCUUGAUUACUUGCACUGGGACGUA
MFE -41.40 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-26-2
Family mir-26 (MIPF0000043)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.