| Accession | MI0031434 |
| Name | oha-mir-26-1 |
| similar to following miRCarta precursors | oha-26214-36961.1 |
| Organism | Ophiophagus hannah |
| Genome | OphHan1.0 |
| Location |
AZIM01000386.1:244,712-244,803 (+) |
| miRNA | oha-miR-26-5p |
| miRNA | oha-miR-26-1-3p |
| Sequence (5' -> 3') (92 nts) |
AAAGGCUGUGGCUAGGUUCAAGUAAUCCAGGAUAGGCUGUAGGUACUGCAAUCAGCCUGUUCUCGAUUACUUGGCCUUGGAGGCAGCCAGCA |
| MFE | -48.40 kcal/mol |
| first miRBase version | 21.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
oha-mir-26-1 |
| Family | mir-26 (MIPF0000043) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |