Accession | MI0031434 |
Name | oha-mir-26-1 |
similar to following miRCarta precursors | oha-26214-36961.1 |
Organism | Ophiophagus hannah |
Genome | OphHan1.0 |
Location |
AZIM01000386.1:244,712-244,803 (+) |
miRNA | oha-miR-26-5p |
miRNA | oha-miR-26-1-3p |
Sequence (5' -> 3') (92 nts) |
AAAGGCUGUGGCUAGGUUCAAGUAAUCCAGGAUAGGCUGUAGGUACUGCAAUCAGCCUGUUCUCGAUUACUUGGCCUUGGAGGCAGCCAGCA |
MFE | -48.40 kcal/mol |
first miRBase version | 21.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (1 precursors) |
oha-mir-26-1 |
Family | mir-26 (MIPF0000043) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |