Precursor miRBase

oha-mir-219-2 (MI0031423)

Accession MI0031423
Name oha-mir-219-2
similar to following miRCarta precursors oha-37111-37110.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01007730.1:8,609-8,687 (-)
miRNA oha-miR-219-5p
miRNA oha-miR-219-2-3p
Sequence (5' -> 3')
(79 nts)
AGCCCUGGCUUGUGAUUGUCCAAACGCAAUUCUUGUCUCUCCACCGAGAGUUGAGUCUGGACAUCAAGAGCCGGGGUUG
MFE -42.70 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-219-2
Family mir-219 (MIPF0000044)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.