Precursor miRBase

oha-mir-21 (MI0031411)

Accession MI0031411
Name oha-mir-21
similar to following miRCarta precursors oha-25101-35934.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01005944.1:49,865-49,945 (+)
miRNA oha-miR-21-5p
miRNA oha-miR-21-3p
Sequence (5' -> 3')
(81 nts)
CUUUCUGUCGGAUAGCUUAUCAGACUGAUGUUGACUGUUGGAUGUCAUGGCAACAACAGUCGGUAGGCUGUCUGACAUUUU
MFE -38.60 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-21
Family mir-21 (MIPF0000060)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.