Precursor miRBase

oha-mir-205a (MI0031406)

Accession MI0031406
Name oha-mir-205a
similar to following miRCarta precursors oha-351-37093.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01005747.1:92,682-92,773 (+)
miRNA oha-miR-205a-5p
miRNA oha-miR-205a-3p
Sequence (5' -> 3')
(92 nts)
AUGCAUUCUGUUGUCCUUCAUUCCACCGGAGUCUGUCUCAUACCUAAUCAGAUUUCAGUGGCAUGAAGUACAUGAGACAUGGAGUUGAAUCA
MFE -28.60 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-205a
Family mir-205 (MIPF0000058)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.