Precursor miRBase

oha-mir-204-1 (MI0031404)

Accession MI0031404
Name oha-mir-204-1
similar to following miRCarta precursors oha-296-898.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000745.1:257,781-257,857 (-)
miRNA oha-miR-204-5p
miRNA oha-miR-204-1-3p
Sequence (5' -> 3')
(77 nts)
CCUGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGGAUAUAUGAAGGGGGCUGGGAAGGCAAAGGGACGUUCAAUUGU
MFE -34.10 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-204-1
Family mir-204 (MIPF0000042)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.