Precursor miRBase

oha-mir-194-1 (MI0031388)

Accession MI0031388
Name oha-mir-194-1
similar to following miRCarta precursors oha-37001-37000.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001511.1:634,495-634,574 (+)
miRNA oha-miR-194-5p
miRNA oha-miR-194-3p
Sequence (5' -> 3')
(80 nts)
AAACAGUGUUAUCAAGUGUAACAGCAACUCCAUGUGGAAUAAAGUCUCUUUCCAGUGGAGGUGGUGUUACUUUUGAAAGC
MFE -28.60 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-194-1
oha-mir-215
Family mir-194 (MIPF0000055)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.