Precursor miRBase

oha-mir-193 (MI0031387)

Accession MI0031387
Name oha-mir-193
similar to following miRCarta precursors oha-36979-300.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000911.1:122,155-122,228 (-)
miRNA oha-miR-193-5p
miRNA oha-miR-193-3p
Sequence (5' -> 3')
(74 nts)
UGGGGCUGGGUCUUUGCGGGCGAGAUGAGAAGUUUCUGCCUUCAACUGGCCUACAAAGUCCCAGUUCUCGGCUC
MFE -33.80 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-193
Family mir-193 (MIPF0000082)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.