Accession | MI0031381 |
Name | oha-mir-18a |
similar to following miRCarta precursors | oha-262-389.1 |
Organism | Ophiophagus hannah |
Genome | OphHan1.0 |
Location |
AZIM01002132.1:158,255-158,334 (-) |
miRNA | oha-miR-18a-5p |
miRNA | oha-miR-18a-3p |
Sequence (5' -> 3') (80 nts) |
UUUUUGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAAUAGAUUAGCAUCUACUGCCCUAAGUGCUCCUUCUGGCAUAAGA |
MFE | -21.70 kcal/mol |
first miRBase version | 21.0 |
last miRBase version | 21.0 |
Clusters (10 kb) (6 precursors) |
oha-mir-92a-1
oha-mir-19b oha-mir-20a oha-mir-19a oha-mir-18a oha-mir-17 |
Family | mir-17 (MIPF0000001) |
Authors | Journal | Year | Pubmed link | Title | |
---|---|---|---|---|---|
1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |