Precursor miRBase

oha-mir-183 (MI0031380)

Accession MI0031380
Name oha-mir-183
similar to following miRCarta precursors oha-24617-37119.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01023994.1:622-697 (+)
miRNA oha-miR-183-5p
miRNA oha-miR-183-3p
Sequence (5' -> 3')
(76 nts)
CUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAAAACACUCGAUCAGUGAAUUACAAAGGGCCAUAAACGGAG
MFE -26.80 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-183
Family mir-183 (MIPF0000066)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.