Precursor miRBase

oha-mir-181a-2 (MI0031376)

Accession MI0031376
Name oha-mir-181a-2
similar to following miRCarta precursors oha-25897-36916.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000021.1:758,346-758,431 (+)
miRNA oha-miR-181a-5p
miRNA oha-miR-181a-2-3p
Sequence (5' -> 3')
(86 nts)
GGUAAAAGUUCUCGGGGAACAUUCAACGCUGUCGGUGAGUUUUGUCAAUGAGGUCAAACCAUCGACUGUUGAGUGUACCCUGCGCU
MFE -32.10 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-181a-2
oha-mir-181c
Family mir-181 (MIPF0000007)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.