Precursor miRBase

oha-mir-181a-1 (MI0031375)

Accession MI0031375
Name oha-mir-181a-1
similar to following miRCarta precursors oha-32-37118.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01017604.1:70-160 (+)
miRNA oha-miR-181a-5p
miRNA oha-miR-181a-1-3p
Sequence (5' -> 3')
(91 nts)
CUUACGAUAGCUUCAGCGAACAUUCAACGCUGUCGGUGAGUUUGGUCCCUCAAGAGAAACCACCGAUCGUUGACUGUACCUUGAGGUUUAU
MFE -29.30 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-181a-1
Family mir-181 (MIPF0000007)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.