Precursor miRBase

oha-mir-16b (MI0031369)

Accession MI0031369
Name oha-mir-16b
similar to following miRCarta precursors oha-36938-36937.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000178.1:249,110-249,192 (-)
miRNA oha-miR-16b-5p
miRNA oha-miR-16b-3p
Sequence (5' -> 3')
(83 nts)
ACUUGUUCCGCUGUAGCAGCACGUAAAUAUUGGUGUAGUAAAGAUAACGCCAAUAUUAUUGUGCUGCUUAAGUGUGACAGGGA
MFE -40.10 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-16b
oha-mir-15a
Family mir-15 (MIPF0000006)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.