| Accession | MI0031365 |
| Name | oha-mir-153-2 |
| similar to following miRCarta precursors | oha-25902-501.1 |
| Organism | Ophiophagus hannah |
| Genome | OphHan1.0 |
| Location |
AZIM01000489.1:385,861-385,935 (-) |
| miRNA | oha-miR-153-2-5p |
| miRNA | oha-miR-153-3p |
| Sequence (5' -> 3') (75 nts) |
GCCAGUGUCAUUUUUGUGAUUUGCAGCUAGUAAUCCUGGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGCUGC |
| MFE | -36.60 kcal/mol |
| first miRBase version | 21.0 |
| last miRBase version | 21.0 |
| Clusters (10 kb) (1 precursors) |
oha-mir-153-2 |
| Family | mir-153 (MIPF0000050) |
| Authors | Journal | Year | Pubmed link | Title | |
|---|---|---|---|---|---|
| 1 | Vonk et al. | Proc. Natl. Acad. Sci. U.S.A. | 2013 | 24297900 | The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system. |