Precursor miRBase

oha-mir-153-1 (MI0031364)

Accession MI0031364
Name oha-mir-153-1
similar to following miRCarta precursors oha-381-501.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000183.1:172,560-172,635 (+)
miRNA oha-miR-153-1-5p
miRNA oha-miR-153-3p
Sequence (5' -> 3')
(76 nts)
UGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUAAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAA
MFE -35.10 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-153-1
Family mir-153 (MIPF0000050)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.