Precursor miRBase

oha-mir-147-1 (MI0031360)

Accession MI0031360
Name oha-mir-147-1
similar to following miRCarta precursors oha-37024-575.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01002333.1:95,970-96,048 (+)
miRNA oha-miR-147-5p
miRNA oha-miR-147-3p
Sequence (5' -> 3')
(79 nts)
CUCUGAAUCUAGUGGAAUCAUUUCUGCACAAACUAGAGGAUGGAAACCAGUGUGCGGAAAUGCUUCUGCUACAUUUUUA
MFE -25.50 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-147-1
Family mir-147 (MIPF0000105)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.