Precursor miRBase

oha-mir-145 (MI0031358)

Accession MI0031358
Name oha-mir-145
similar to following miRCarta precursors oha-55-36947.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000254.1:119,187-119,258 (-)
miRNA oha-miR-145-5p
miRNA oha-miR-145-3p
Sequence (5' -> 3')
(72 nts)
UCGGGGUCCAGUUUUCCCAGGAAUCCCUUAGAAGAUAAGAAGGGGAUUCCUGGAAAUACUGUUCUUGGGGUC
MFE -31.00 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-145
oha-mir-143
Family mir-145 (MIPF0000079)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.