Precursor miRBase

oha-mir-143 (MI0031356)

Accession MI0031356
Name oha-mir-143
similar to following miRCarta precursors oha-36948-3.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000254.1:119,771-119,838 (-)
miRNA oha-miR-143-5p
miRNA oha-miR-143-3p
Sequence (5' -> 3')
(68 nts)
CCCAAGGUGCAGUGCUGCAUCUCUGGUCAGUUGUGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGGG
MFE -31.50 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-145
oha-mir-143
Family mir-143 (MIPF0000094)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.