Precursor miRBase

oha-mir-142 (MI0031355)

Accession MI0031355
Name oha-mir-142
similar to following miRCarta precursors oha-25833-25103.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001308.1:316,277-316,374 (-)
miRNA oha-miR-142-5p
miRNA oha-miR-142-3p
Sequence (5' -> 3')
(98 nts)
UAUGGACAGUGGACUCAUCCAUAAAGUAGAAAGCACUACUAAACGCUUGUGUCCAAGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGAGCAA
MFE -51.80 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-142
Family mir-142 (MIPF0000084)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.