Precursor miRBase

oha-mir-140 (MI0031354)

Accession MI0031354
Name oha-mir-140
similar to following miRCarta precursors oha-36990-26093.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01001080.1:153,801-153,879 (+)
miRNA oha-miR-140-5p
miRNA oha-miR-140-3p
Sequence (5' -> 3')
(79 nts)
GGUGUCCCGCCAGUGGUUUUACCCUAUGGUAGGUGACCUGGUGCUGUUCUACCACAGGGUAGAACCACGGACGGGAUGC
MFE -46.00 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-140
Family mir-140 (MIPF0000085)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.