Precursor miRBase

oha-mir-133a-3 (MI0031344)

Accession MI0031344
Name oha-mir-133a-3
similar to following miRCarta precursors oha-36958-36957.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01000323.1:267,287-267,367 (+)
miRNA oha-miR-133a-3-5p
miRNA oha-miR-133a-3p
Sequence (5' -> 3')
(81 nts)
UGUGCUCCUGGGGCUGGUAAAAAGGAACCAGAUCGACUGGCGACUGAUUUGGUCCCCUUCAACCAGCUGGGGGGGCACAAA
MFE -39.50 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(2 precursors)
oha-mir-1d
oha-mir-133a-3
Family mir-133 (MIPF0000029)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.