Precursor miRBase

oha-mir-130d (MI0031338)

Accession MI0031338
Name oha-mir-130d
similar to following miRCarta precursors oha-25841.1
Organism Ophiophagus hannah
Genome OphHan1.0
Location AZIM01005047.1:32,145-32,238 (-)
miRNA oha-miR-130d
Sequence (5' -> 3')
(94 nts)
CUCUGGGGCAGUCUGCUACUCUUUCUUUGUUGCGCUCCUGUCCAGCAUCACCUCUAGCAGUGCAAUAAUGAAAGGGCAUCAGCCACUCCACAAA
MFE -29.10 kcal/mol
first miRBase version 21.0
last miRBase version 21.0
Clusters (10 kb)
(1 precursors)
oha-mir-130d
Family mir-130 (MIPF0000034)

Predicted Structure

References

Authors Journal Year Pubmed link Title
1 Vonk et al. Proc. Natl. Acad. Sci. U.S.A. 2013 24297900 The king cobra genome reveals dynamic gene evolution and adaptation in the snake venom system.